Jump to content
Science Forums

cpu68

Members
  • Content Count

    11
  • Joined

  • Last visited

  1. Visualization of nucleotide sequence invented in 2015 by Polish scientist Gregory Podgorniak, above this sequence - TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAG TTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGA TATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT CCGGTATGAATTCTCCGCGCAATAAGCCATCTCCCTACCGCATTGCATCAAAGCATTTCACAGCAGTCCAGCCC CGAGGTTCAGGGTCTCGGAGCTTCTGTCGACAGTAACAACCGGGTCGTGCCCGCCATCAATCGGTATCTTAAAT AAATAGAAATCTTTAGAGGCCGGTGGTAATACAGTTAGATCGACATAGTAAATAGGCTCAGAACTA CTACGTATAAGGCGCTCTGATTGACGAAATGAGAACTAGAGCA
  2. Hitler is unique, poses the greatest threat and is unmatched in terms of coverage and impact. Just Napoleon is a good example because it was almost certainly the earlier incarnation of Hitler. The existence of major religions shows that there are not many gods to choose from, and they can all come from one source, I will add that we are not a god or gods
  3. we are threatened by annihilation of the biosphere
  4. Religion is not bullshit, faith in God is not fairy tales, and believe in reincarnation.
  5. If you don't believe in reincarnation, you are wrong. Reincarnation is a fact and the threat presented is real.
  6. Return of a big danger... One can believe or not into theory of reincarnation, but for my money this is one from religious conceptions which is valid - of course after certain and pretty thorough corrections, for example conception of karma is in big degree a superstition. Now in years 2040-2070, it can be expected following public activity of A.Hitler. This information can appear insomuch important that probably he will lead to unleashing of nuclear war, what predictably will cause annihilation of biosphere. It is worth to notice that if he caused eruption of World War II so on the same bas
  7. (the author of the text comes from outside of Anglosaxon lingual area)
  8. (the author of the text comes from outside of Anglosaxon lingual area) Cognition is not only structurally limited to sensations, but no subject can go beyond itself to convince not only that matter exists but even that there are other subjects. Solipsism thus understood seems impassable, assuming the existence of other subjects, we could also assume the existence of something beyond the experience, this is the strongest argument against Berkeley's theory, an argument from solipsism that is more consistent than Berkeley's. Such a solipsistic limitation of knowledge seems unbearable, and on th
  9. author of conception Gregory Podgorniak, Poland 2011
  10. Electrons, quarks and gluons possess internal structure, consist of quadrillion of particles of size about 10^-35 m [they correspond with photons], these then from quadrillion of particles about 10^-50 m and these then from quadrillion of particles about 10^-65 m [they correspond with gravitons]. To confirm legitimacy of assuming of hypothesis of internal structure of smallest from hitherto known structural subatomic particles as electrons, quarks and gluons it can be invoked the theory of science created by A.Comte (see after text Comte's Theory of Science). diagram. Galatical model Ev
×
×
  • Create New...